COLx
------------------------------------------------------------------------------
COLx is a plugin for GFF-Ex. COLx exports feature coordinates from specified columns and translates them into sequences using GFF-Ex


System Requirements
------------------------------------------------------------------------------
1. OS Platform:- Linux
2. Perl 4.0, or above
3. GFF-Ex_v2.2


Required Input Files
-----------------------------------------------------------------------------
1. A tab-delimited multi-column file.
2. Columns numbers to fecth the desired column information.
3. Sequence file in fasta format. (.fa, .fasta, fna, etc.)


Inputs Example Files
-----------------------------------------------------------------------------
1. Multi-column File	/COLx/examples/input
2. Desired Columns	START	END
					9		10		
3. Sequence File:		/GFF_v2.1/examples/sequence.fasta


Output Files													Preffix(Plugin Name)_Suffix(Input multicolumnfile/sequencefile)
-----------------------------------------------------------------------------				
1. Multi-column file wth unique ID i.e their Sr. Nos.				- OUTPUTFILE:	ID_(input "multi-column" filename).gff
2. Desired Sequences								- OUTPUTFILE:	colx_(input "genome" filename)

Note: The output sequences will be in fasta format and the header of each seqeunce will state the Serial Number or Unique IDs preffixed with the plugin name (eg. Colx_1). Unique IDs/Serial Number will be in accordance to the IDs/Serial Number (first column) in the Unique-ID file [OUTPUTFILE: ID_(input "multi-column" filename).gff].

Installation
-----------------------------------------------------------------------------
1. Download COLx.tar.gz
2. sudo -s
3. gunzip COLx.tar.gz
4. tar -vxf COLx.tar
5. cd COLx
6. ./install.sh <GFF_INTALLATION_PATH>          ------configures the installtion path and install the program
7. source GFF_INSTALLATION_PATH/gff_profile     [NOTE:Please run this command prior to the execution of COLx]
8. Using same terminal move to the directory containing the input files and run COLx [GFF_INSTALLATION_PATH/gffex -pl colx -in <tab_delimited_inputfile> -cl XX YY -db <genome_file>]


Usage
-----------------------------------------------------------------------------
1. Using terminal, move to the working directory containing your input files.
2. run COLx using command "GFF_INSTALLATION_PATH/gffex -pl [colx] -in [multi-columnfile] -cl [START column no.] [END column no.] -db [seqeuncefile]"		[example] GFF_INSTALLATION_PATH/gffex -pl colx -in input -cl 9 10 -db seqeunce.fasta

##########################################################################################
##################################### EXAMPLE RUN ########################################
##########################################################################################

INPUT1 (tab delimited file with column 7 as start position and column 8 as end position)
------

XXXX    XXXX    XXXX    XXXX    XXXX    XXXX    1       10      XXXX    XXXX
XXXX    XXXX    XXXX    XXXX    XXXX    XXXX    11      15      XXXX    XXXX
XXXX    XXXX    XXXX    XXXX    XXXX    XXXX    20      28      XXXX    XXXX
XXXX    XXXX    XXXX    XXXX    XXXX    XXXX    35      44      XXXX    XXXX

INPUT2
------

>example
CGATGCTATGCTGTAGCGATGCGACATGCATGCATGCTAGCGATCGGCGACGTAGCGATCGTAGCAGCTACATCAC
ACTATCGTAGCTAGTCGTGCAGCTGCTAGTCGATGCAGCGCTAGCTCGAGCTCTGTGCATGTAGCACGACTAGCCA
TCTACGATGCTAGTCTAGCAGCGATCGTAGTCACTGACGATC


[COLx_run]$ source GFF/INSTALLATON_PATH/gff_profile
[COLx_run]$ GFF_INSTALLATION_PATH/gffex -pl colx -in INPUT1 -cl 7 8 -db INPUT2


OUTPUT
------

>COLx_1
CGATGCTATG

>COLx_2
CTGTA

>COLx_3
TGCGACATG

>COLx_4
TGCTAGCGAT

##########################################################################################
##################################### EXAMPLE RUN ########################################
##########################################################################################


DeveloperZ Information
------------------------------------------------------------------------------
Achal Rastogi
(Dr. Dinesh Gutpa Group)
Research Fellow
Bioinformatics Facility
Structural & Computational Biology Laboratory
International Center for Genetic Engineering And Biotechnology
Aruna Asaf Ali Marg, New Delhi 110067 India
Email: achal@icgeb.res.in


NOTES
------------------------------------------------------------------------------
1. Being in the directory containing input files is a prerequisite for running GFF-Ex, to avoid output errors.
2. Take care of the inputs, wrong inputs may fetch you with wrong results.